Skip to main content

Advertisement

Table 2 Primers and probes used in this study

From: Molecular investigation and phylogeny of Anaplasmataceae species infecting domestic animals and ticks in Corsica, France

Targeted microorganisms Targeted gene Primers and probea Sequences 5′-3′ Annealing temperature (°C) References
  qPCR  
Anaplasmataceae 23S rRNA TtAna-F
TtAna-R
TtAna-Sa
TGACAGCGTACCTTTTGCAT
GTAACAGGTTCGGTCCTCCA
FAM-CTTGGTTTCGGGTCTAATCC-TAMRA
60 [28, 29]
  Conventional PCR  
Anaplasmataceae 23S rRNA Ana23S-212f
Ana23S-753r
ATAAGCTGCGGGGAGTTGTC
TGCAAAAGGTACGCTGTCAC
55 [28, 29]
Anaplasma spp. rpoB Ana-rpoBF
Ana-rpoBR
GCTGTTCCTAGGCTYTCTTACGCGA
AATCRAGCCAVGAGCCCCTRTAWGG
55 [27]
Ehrlichia spp. groEL Ehr-groEL-F
Ehr-groEL-R
GTTGAAAARACTGATGGTATGCA
ACACGRTCTTTACGYTCYTTAAC
50 [27]
Ticks 12S rRNA T1B
T2A
AAACTAGGATTAGATACCCT
AATGAGAGCGACGGGCGATGT
51 [26]
  1. aProbe