Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer sequences of Irf8, PU.1, Batf3, Id2, Nfil3 genes used in the RT-PCR

From: Absence of Batf3 results in reduced liver pathology in mice infected with Schistosoma japonicum

   sequence (5'→3')
β-actin sense TTCCTTCTTGGGTATGGAAT
antisense GAGCAATGATCTTGATCTTC
Irf8 sense GGGTCAGTACACAACAGGGG
antisense CTAGCTGCGTGGAGCATGTA
PU.1 sense CCTCGATACTCCCATGGTGC
antisense GGCTGGGGACAAGGTTTGAT
Batf3 sense TTTGTGCAGCTTCGGTCAGA
antisense CCGGACAAAGGAGGAGTGAG
Id2 sense CGGGGCTGATCTGGGAAAAT
antisense CACAGCGTAACCTCGTCTTC
Nfil3 sense ATGTTACAGGCGTGCAAAATGG
antisense TGATCGCTATGGCTTTCTCCA