Table 1 Species-specific oligonucleotide sequences for S. haematobium and S. bovis that were covalently bound on BiodynC membranes used in the RLB analysis
Oligo number | Schistosoma species | Oligo name | Oligo-nucleotide sequence (5′ Amino modified) |
|---|---|---|---|
1 | S. haematobium | Sholigo1 | CTAGAATAAGGGCTGTTCTA |
2 | S. haematobium | Sholigo2 | ACTTTGCTTCGTCTGATATG |
3 | S. bovis | Sbovoligo1 | AACCAAACAAGACGTACACA |
4 | S. bovis | Sbovoligo2 | GACGTACACACCCAGCTCCA |