Skip to main content

Table 1 List and characteristics of primers designed in this study

From: Detecting and characterizing mixed infections with genetic variants of Anaplasma phagocytophilum in roe deer (Capreolus capreolus) by developing an ankA cluster-specific nested PCR

Primer type Primer name Sequence 5′–3’ Cluster specificitya Melting temperature (°C) Amplicon size (bp)
External primers Ana-Ext-F2 TCTGMAAGCCATTATCAYAG I, II, III, IV 58 1609
Ana-Ext-R1 TGCTTCACGAARCGCATA
Internal primers Ana-Int-F1 CATCKAGCAKGTRTTGAAGG I, II, III, IV 58 731–737
Ana-Int-R3 TGTARAGGRGCARMACC
Sequencing primers Ana-Int-F2 GCGAGTGTGCAGASKCACTA I, II, III, IV 58 328
Ana-Int-R3 TGTARAGGRGCARMACC
Internal cluster-specific primers Ana-F-Cl2 GTGACAATTTTGRGACATTAC II 60 1512
Ana-R-Cl2 TCCTAGTCCGCGAGCTAAGT
Ana-F-Cl3 GTGAGAATTTTGAGTCATTG III 60 1512
Ana-R-Cl3 TCCGAACCCGRGCGCTCAT
Ana-F-Cl4b GAGGTATCTAGGAAGTGCC IV 61 1286
Ana-R-Cl4 TCAAGTTCCGTGCGGTTAGG
  1. aCluster numbers as in [6]