Skip to main content

Table 1 Real-time quantitative PCR primer sequences

From: Praziquantel treatment after Schistosoma japonicum infection maintains hepatic insulin sensitivity and improves glucose metabolism in mice

Gene Direction Sequence (5′-3′)
GAPDH Forward AACTTTGGCATTGTGGAAGG
Reverse GGATGCAGGGATGATGTTCT
IRS-1 Forward GGTCACGAAGAGCTGGTGCACT
Reverse GAGGCGCATCATGGAACACGG
IRS-2 Forward GCTCCCTGTTCCTGCAGCGG
Reverse CAAAGGTGCCAGCCCCTGGG
INSR Forward GATGTGCACCCCATGTCTG
Reverse CTGAATAGCTGAGACCACAG
G6PC Forward TTACCAAGACTCCCAGGACTG
Reverse GAGCTGTTGCTGTAGTAGTCG
GLUT4 Forward TGTATGTGGGAGAAATCGC
Reverse GACAGAAGGGCAGCAGAAT
TNF-α Forward CATCTTCTCAAAATTCGAGTGACAA
Reverse TGGGAGTAGACAAGGTACAACCC
IL-6 Forward GAGGATACCACTCCCAACAGACC
Reverse AAGTGCATCATCGTTGTTCATACA
IL-1β Forward GCACACCCACCCTGCA
Reverse ACCGCTTTTCCATCTTCTTCTT
TGF-β1 Forward ATGCTAAAGAGGTCAAAAGC
Reverse CCAAGGTAACGCCAGGAATT
IL-10 Forward ACTTTAAGGGTTACTTGGGTTGC
Reverse ATTTTACAAGGGGAGAAATCG
IL-13 Forward GCCAGCCCACAGTTCTAC
Reverse GAGATGTTGGTCAGGGAAT
IL-22 Forward GTCAACCGCACCTTTATGCT
Reverse CATGTAGGGCTGGAACCTGT
IL-33 Forward GATGGGAAGAAGGTGATGGTG
Reverse TTGTGAAGGACGAAGAAGGC