Skip to main content

Advertisement

Table 1 Primer sets used to detect haemococcidians in the present study

From: Phylogenetic analyses reveal that Schellackia parasites (Apicomplexa) detected in American lizards are closely related to the genus Lankesterella: is the range of Schellackia restricted to the Old World?

Primer Sequence 5′– 3′ Amplicon size (bp)
BT-F1 GGTTGATCCTGCCAGTAGT 1626
Hep1600R AAAGGGCAGGGACGTAATCGG
BT-F1 As above 1580
EimIsoR1 AGGCATTCCTCGTTGAAGATT
BT-F1 As above 1528
EimIsoR3 GCATACTCACAAGATTACCTAG