Skip to main content

Table 1 Sequences of primers used in this study

From: A multiplex PCR for detection of knockdown resistance mutations, V1016G and F1534C, in pyrethroid-resistant Aedes aegypti

Primer name Primer sequence (5′-3′) Product size (bp) Exona
Direct sequencing
 IIP_F GGTGGAACTTCACCGACTTC 581 15
 IIS6_R GGACGCAATCTGGCTTGTTA 16
 Ge-IIIS6_F GCTGTCGCACGAGATCATT 635 23
 IIIS6_R GTTGAACCCGATGAACAACA 25
Multiplex PCR
 1016 genotyping
  Gly1016f ACCGACAAATTGTTTCCC   15–16b
  Val1016r [short GC tail]c AGCAAGGCTAAGAAAAGGTTAATTA 60 16
  Gly1016r [long GC tail]d AGCAAGGCTAAGAAAAGGTTAACTC 80 16
 1534 genotyping
  c1534-f GCGTACCTGTGTCTGTTCCA 368 23
  c1534-r GGCTTCTTCGAGCCCATCTT 24
  Ae1534F-r GCGTGAAGAACGACCCGA 232 24
  Ae1534C-f CCTCTACTTTGTGTTCTTCATCATCTG 180 24
  1. aExon from the Ae. aegypti VGSC gene. This transcript corresponds to VectorBase Transcript ID AAEL006019
  2. bIntron between exon 15 and 16
  3. cShort GC tail sequence: 5′-GCG GGC-3’
  4. dLong GC tail sequence: 5′-GCG GGC AGG GCG GCG GGG GCG GGG CC-3′