Skip to main content

Table 2 PCR primers used in this study

From: Prevalence and multilocus genotyping of Giardia duodenalis in pigs of Shaanxi Province, northwestern China

Gene locus Primer name Sequence (5'-3') Amplicon length (bp) Annealing temperature (°C) Reference
bg G7-F TCAACGTYAAYCGYGGYTTCCGT 573 52 [35]
G759-R CAGTACACCTCYGCTCTCGG  
G99-F GAACGAACGAGATCGAGGTCCG 511 55  
G609-R CTCGACGAGCTTCGTGTT  
tpi AL3543 AAATIATGCCTGCTCGTCG 605 50 [34]
AL3546 CAAACCTTITCCGCAAACC  
AL3544 CCCTTCATCGGIGGTAACTT 530 58  
AL3545 GTGGCCACCACICCCGTGCC  
gdh GDHeF TCAACGTYAAYCGYGGYTTCCGT 432 52 [35]
GDHeR GTTRTCCTTGCACATCTCC  
GDHiF CAGTACACCTCYGCTCTCGG 432 65  
GDHiR GTTRTCCTTGCACATCTCC