Skip to main content

Table 1 Sequence-tagged site (STS) primer sets used in this study targeting SSU rRNA gene of Blastocystis

From: Distribution of Blastocystis subtypes isolated from humans from an urban community in Rio de Janeiro, Brazil

Primer pair Target subtype Primer type Sequence (5′-3′)
SB83 ST1 F GAAGGACTCTCTGACGATGA
   R GTCCAAATGAAAGGCAGC
SB340 ST2 F TGTTCTTGTGTCTTCTCAGCTC
   R TTCTTTCACACTCCCGTCAT
SB227 ST3 F TAGGATTTGGTGTTTGGAGA
   R TTAGAAGTGAAGGAGATGGAAG
SB337 ST4 F GTCTTTCCCTGTCTATTCTGCA
   R AATTCGGTCTGCTTCTTCTG
SB336 ST5 F GTGGGTAGAGGAAGGAAAACA
   R AGAACAAGTCGATGAAGTGAGAT
SB332 ST6 F GCATCCAGACTACTATCAACATT
   R CCATTTTCAGACAACCACTTA
SB155 ST7 F ATCAGCCTACAATCTCCTC
   R ATCGCCACTTCTCCAAT