45 ticks (n = 9) significantly differed for B. burgdorferi (s.l.), Rickettsia spp., and "Ca. N. mikurensis", but were not related to the habitat type. Three hundred fifty eight out of 1078 I. ricinus ticks (33.2%) tested positive for at least one pathogen. Thereof, about 20% (71/358) were carrying two or three different potentially disease-causing agents. Using next generation sequencing, we could detect true pathogens, tick symbionts and organisms of environmental or human origin in ten selected samples. Conclusions Our data document the presence of pathogens in the (sub-) urban I. ricinus tick population in Switzerland, with carrier rates as high as those in rural regions. Carriage of multiple pathogens was repeatedly observed, demonstrating the risk of acquiring multiple infections as a consequence of a tick bite."/>
Skip to main content

Table 1 Real-time (RT-PCR) systems used for screening tick samples for the presence of various pathogens

From: Prevalence of tick-borne pathogens in questing Ixodes ricinus ticks in urban and suburban areas of Switzerland

Pathogen Primer sequences (5'–3') Amplicon length (bp) PCR cyclera Mastermix Protocol Reference primer sequences
A. phagocytophilum locus: major surface protein 2 (msp2) gene (forward: ATG GAA GGT AGT GTT GGT TAT GGT ATT; reverse: TTG GTC TTG AAG CGC TCG TA; probe: FAM-TGG TGC CAG GGT TGA GCT TGA GAT TG-BHQ1) 75 AB QuantStudio 12K Flex LightCycler Multiplex DNA Master & 50 nM external ROX (final primer conc.: 0.5 μM; final probe conc.: 0.25 μM; reaction volume: 10 μl; sample volume: 2.5 μl) Initial denaturation/polymerase activation (95 °C, 30 s); 2-step-amplification (45× 95 °C, 5 s; 60 °C, 30 s); cooling (40 °C, 30 s) [108]
Babesia spp. locus: 18S ribosomal RNA gene (forward: TGA ACG AGG AAT GCC TAG TATG; reverse: CCG AAT AAT TCA CCG GAT CAC TC; probe: FAM-AAG TCA TCA GCT TGT GCA GAT TAC GTC CCT-BHQ1) 116 AB QuantStudio 12K Flex LightCycler Multiplex DNA Master & 50 nM external ROX (final primer conc.: 0.5 μM; final probe conc.: 0.25 μM; reaction volume: 10 μl; sample volume: 2.5 μl) Initial denaturation/polymerase activation (95 °C, 30 s); 2-step-amplification (45× 95 °C, 5 s; 60 °C, 30 s); cooling (40 °C, 30 s) [65]
B. microti locus: 18S ribosomal RNA gene (forward: CAG GGA GGT AGT GAC AAG AAA TAA CA; reverse: GGT TTA GAT TCC CAT CAT TCC AAT; probe: FAM-TAC AGG GCT TAA AGT CT-MGBNFQ) 71 AB QuantStudio 12K Flex LightCycler Multiplex DNA Master & 50 nM external ROX (final primer conc.: 0.5 μM; final probe conc.: 0.25 μM; reaction volume: 10 μl; sample volume: 2.5 μl) Initial denaturation (95 °C, 30 s); 2-step-amplification (45× 95 °C, 5 s; 60 °C, 30 s); cooling (40 °C, 30 s) [109]
Borrelia spp. locus: 16S ribosomal RNA gene (forward: GGTCAAGACTGACGCTGAGTCA; reverse: GCGGCACACTTAACACGTTAG; probe: FAM-TCT ACG CTG TAA ACG ATG CAC ACT TGG TG-BHQ1) 136 Roche LightCycler 96 TaqMan Fast Advanced Master Mix (final primer conc.: 0.4 μM; final probe conc.: 0.25 μM; reaction volume: 25 μl; sample volume: 5 μl) Uracil-N glycosylase incubation (50 °C, 120 s); initial denaturation/polymerase activation (95 °C, 20 s); 2-step-amplification (45× 95 °C, 3 s; 60 °C, 30 s) [110]
B. miyamotoi locus: 16S ribosomal RNA gene (forward: CGC TGT AAA CGA TGC ACA CTT GGT GTT AAT C; reverse: CGG CAG TCT CGT CTG AGT CCC CAT CT;probe: FAM-CCT GGG GAG TAT GTT CGC AAG AAT GAA ACT C-BHQ1) 352 Roche LightCycler 96 TaqMan Fast Advanced Master Mix (final primer conc.: 0.4 μM; final probe conc.: 0.25 μM; reaction volume: 25 μl; sample volume: 5 μl) Uracil-N glycosylase incubation (50 °C, 120 s); initial denaturation/polymerase activation (95 °C, 20 s); 2-step-amplification (45× 95 °C, 3 s; 60 °C, 30 s) [19]
"Ca. Neoehrlichia mikurensis" locus: 16S ribosomal RNA gene (forward: ATC CTG GCT CAG AAC GAA CG; reverse: TGA TCG TCC TCT CAG ACC AGC; probe: FAM-ACC CAT AGT AAA CTA CAG CTA CA-MGBNFQ) 280 AB QuantStudio 12K Flex LightCycler Multiplex DNA Master & 50 nM external ROX (final primer conc.: 0.5 μM; final probe conc.: 0.25 μM; reaction volume: 10 μl; sample volume: 2.5 μl) Initial denaturation/polymerase activation (95 °C, 30 s); 2-step-amplification (45× 95 °C, 5 s; 60 °C, 30 s); cooling (40 °C, 30 s) [99]
Rickettsia spp. locus: citrate synthase-encoding gene (gltA) (forward: TCG CAA ATG TTC ACG GTA CTT T; reverse: TCG TGC ATT TCT TTC CAT TGT G; probe: FAM-TGC AAT AGC AAG AAC CGT AGG CTG GAT G-BHQ1) 74 AB QuantStudio 12K Flex LightCycler Multiplex DNA Master & 50 nM external ROX (final primer conc.: 0.5 μM; final probe conc.: 0.25 μM; reaction volume: 10 μl; sample volume: 2.5 μl) Initial denaturation/polymerase activation (95 °C, 30 s); 2-step-amplification (45× 95 °C, 5 s; 60 °C, 30 s); cooling (40 °C, 30 s) [26]
R. helvetica locus: 23S ribosomal RNA gene (forward: TTT GAA GGA GAC ACG GAA CAC A; reverse: TCC GGT ACT CAA ATC CTC ACG TA; probe: FAM-AAC CGT AGC GTA CAC TTA-MGBNFQ) 65 AB QuantStudio 12K Flex LightCycler Multiplex DNA Master & 50 nM external ROX (final primer conc.: 0.5 μM; final probe conc.: 0.25 μM; reaction volume: 10 μl; sample volume: 2.5 μl) Initial denaturation/polymerase activation (95 °C, 30 s); 2-step-amplification (45× 95 °C, 5 s; 60 °C, 30 s); cooling (40 °C, 30 s) [26]
TBEV locus: envelope gene (forward: GGT TTG TGA GGC AAA AAA GAA; reverse: TCC CGT GTG TGG TTC GAC TT; probe: FAM-AAG CCA CAG GAC ATG TGT ACG ACG CC-BHQ1) 88 AB QuantStudio 12K Flex LightCycler Multiplex RNA Virus Master & 50 nM external ROX (final primer conc.: 0.5 μM; final probe conc.: 0.25 μM; reaction volume: 10 μl; sample volume: 2.5 μl) Reverse transcription (50 °C, 600 s); initial denaturation (95 °C, 30 s); 2-step-amplification (45× 95 °C, 5 s; 60 °C, 30 s); cooling (40 °C, 30 s) [10]
  1. aPipetting of Roche LightCycler 96 well plates was done using the QIAgility system (Qiagen); for pipetting of MicroAmp Optical 384 well plates the Hamilton Microlab Star was used