Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Target genes and primers used in this study [26, 27]

From: Molecular and serological detection of bovine babesiosis in Indonesia

Species Target gene Method Primer name Oligonucleotide sequence (5′–3′) Product size (bp)
B. bovis SBP-4 PCR bov-SBP-4-F AGTTGTTGGAGGAGGCTAAT 907
   bov-SBP-4-R TCCTTCTCGGCGTCCTTTTC
   nPCR bov-SBP-4-nF GAAATCCCTGTTCCAGAG 503
   bov-SBP-4-nR TCGTTGATAACACTGCAA
B. bigemina RAP-1a PCR big-RAP-1a-F GAGTCTGCCAAATCCTTAC 879
   big-RAP-1a-R TCCTCTACAGCTGCTTCG
   nPCR big-RAP-1a-nF AGCTTGCTTTCACAACTCGCC 412
   big-RAP-1a-nR TTGGTGCTTTGACCGACGACAT
B. bovis ITS region PCR bov-ITS-F CGTCCCTGCCCTTTGTA 815
    bov-ITS-R TATTTTCTTTTCTGCCGCTT  
   nPCR bov-ITS-nF CACCACCAGTGGAAGCAC 545
    bov-ITS-nR TTGTGCCCCATGGACACT  
B. bigemina ITS region PCR big-ITS-F CGTCCCTGCCCTTTGTA 1041
    big-ITS-R TATTTTCTTTTCTGCCGCTT  
   nPCR big-ITS-nF AGTGGTCGGGACTCGTC 495
    big-ITS-nR AGTACCGCGTGCGAGCAG