Skip to main content

Table 1 PCR primes for genotyping ROP16, GRA3 and GRA15

From: Genotyping of polymorphic effectors of Toxoplasma gondii isolates from China

Marker External primers for multiplex PCR Internal primers for nested PCR Restriction digestion
ROP16 ROP16-Fext: TCGTCCCGAATGCTGATGCCACGTC ROP16-Fint: AAGCAACCGTGGTACGTCGAGGTTC No restriction enzyme needed. Sequencing using double deoxidizing terminal cessation method
ROP16-Rext: ATGCCCAAAGCCGTGGACATCGATC ROP16-Rint: TCCATGCGCGAATCCAAGTTCGTG
GRA15 GRA15-Fext2: GCGTACATGGTTATGCGACG GRA15-Fint2: GGTCATTGTCTGCAGACTGAT No restriction enzyme needed. Sequencing using double deoxidizing terminal cessation method
GRA15-Rext2: CATTCCAGTCCCTAAGTTCCCT GRA15-Rint1: CCCTTATCGGTTTTTGGTCA
GRA3 GRA3-Fext: CCTTATTTAATGTTAGATCATCCCG GRA3-Fint: AGGTACGCGTCGAGTAACCAGT No restriction enzyme needed. Sequencing using double deoxidizing terminal cessation method
GRA3-Rext: ACACCCGGTAGCAAGCGTTCA GRA3-Rint: CCCGAGAGAGACTGGCACGA