Skip to main content

Table 1 Primers for tick species and tick-borne pathogen detections in hard ticks (Ixodidae) of birds in Taiwan

From: Tick-borne pathogens in ticks collected from birds in Taiwan

  Gene target Primers Sequences (5′-3′) Product size (bp) Method Reference
Tick species 12S rRNA gene T1B AAACTAGGATTAGATACCCT 379 PCR [60]
   T2A AATGAGAGCGACGGGCGATGT    
  16S rRNA gene 16S + 1 CTGCTCAATGATTTTTTAAATTGCTGTGG 452 PCR [59]
   16S-1 CCGGTCTGAACTCAGATCAAGTA    
   BmR1 TGTTATTGCCTTACACTTCCTTGC    
   BmF2 ACGGCTACCACATCTAAGGAAGGC    
   BmR2 TCTCTCAAGGTGCTGAAGGA    
Anaplasma spp. and Ehrlichia spp. 16S rRNA gene EHR 16SD GGTACC(C/T)ACAGAAGAAGTCC 306 Real time PCR [119]
EHR 16SR TAGCACTCATCGTTTACAGC
Rickettsia spp. OmpB rompB OF GTAACCGGAAGTAATCGTTTCGTAA 426 or 250 Nested PCR [120]
rompB OR GCTTTATAACCAGCTAAACCACC
rompB SFG IF GTTTAATACGTGCTGCTAACCAA
SFG/TG IR GGTTTGGCCCATATACCATAAG
rompB TG IF AAGATCCTTCTGATGTTGCAACA
gltA RpCS.877p GGGGGCCTGCTCACGGCGG 338 Nested PCR
RpCS.1258n AATGCAAAAAGTACAGTGAACA
RpCS.896 GGCTAATGAAGCAGTGATAA
RpCS.1233n GCGACGGTATACCCATAGC
Borrelia spp. rrf(5S)-rrl(23S) 5S–F CGACCTTCTTCGCCTTAAAGC 226–266 Nested PCR [121]
23S–R TAAGCTGACTAATACTAATTACCC
5S–rrf CTGCGAGTTCGCGGGAGA
23S–rrl TCCTAGGCATTCACCATA
Babesia spp. 18S rRNA gene BmF1 GCGATGTATCATTCAAGTTTCTG 700 Nested PCR [122]
BmR1 TGTTATTGCCTTACACTTCCTTGC
BmF2 ACGGCTACCACATCTAAGGAAGGC
BmR2 TCTCTCAAGGTGCTGAAGGA