Skip to main content

Table 1 List of primers used in the SYBR green-based qRT-PCR analysis

From: Dynamic expression of cytokine and transcription factor genes during experimental Fasciola gigantica infection in buffaloes

Gene target Primer sequence (5′–3′) Product length (bp) Reference
GAPDH F CCTGCACCACCAACTGCTTG 222 [62]
R TTGAGCTCAGGGATGACCTTG
IFN-γ F GTCTCCTTCTACTTCAAACT 253 [63]
R ATTCTGACTTCTCTTCCGCT
TGF-β F CGTGCTAATGGTGGAATAC 208 Present study
R GCCAGGAATTGTTGCTATA
IL-1β F CTAGCCCATGTGTGCTGAAG 59 [62]
R CCTTTACTTGGCTCTTCACC
IL-4 F CAGCATGGAGCTGCCT 177 [64]
R ACAGAACAGGTCTTGCTTGC
IL-6 F CTGCAATGAGAAAGGAGATA 191 [63]
R GGTAGTCCAGGTATATCTGA
IL-10 F CTGTGCCTCTCCCCTAGAGT 236 [62]
R GCAGCTAGCTCCACAAGGAA
IL-12B F CAGGGACATCATCAAACCAG 213 [63]
R CTTGTGGCATGT GACTTTGG
IL-13 F AGAACCAGAAGGTGCCGCT 50 [65]
R GGTTGAGGCTCCACACCATG
IL-17A F CTACAGTGAACTGGAAGGAAC 554 Present study
R AAAAGGGGCTGGGTCT
T-bet F CCTGGACCCAACTGTCAACT 171 [66]
R GAAACTCGGCCTCATAGCTG
GATA-3 F GATCAAGCCCAAGCGAAGG 124 Present study
R CCGCAGGCATTGCAGACA
Foxp3 F GACAGCACCCTTTCGACTGT 191 [66]
R CTCCAGAGATTGCACCACCT
ROR-γτ F CTACAGTGAACTGGAAGGAAC 554 Present study
R AAAAGGGGCTGGGTCT
  1. Abbreviations: F forward primer, R reverse primer