Skip to main content

Table 1 Primers used in this study to amplify different Trypanosoma species

From: Molecular screening of tsetse flies and cattle reveal different Trypanosoma species including T. grayi and T. theileri in northern Cameroon

Name Sequence (5′–3′) TA (°C) Amplicon size (bp) Species Reference
ITS1-OutF TGCAATTATTGGTCGCGC 54 Variable All Trypanosoma species [22]
ITS1-OutR CTTTGCTGCGTTCTT
ITS1-InF TAGAGGAAGCAAAAG
ITS1-InR AAGCCAAGTCATCCATCG
TCON-OutF TGCAATTATTGGTCGCGC 54 681 (kilifi) or 781 (forest) T. congolense [22]
TCON-OutR TGCAATTATTGGTCGCGC
TCON-InF TCGCGTGTCTCACGT
TCON-InR TCAAAGATTGGGCAATGT
TGR-OutF TGGCAGACACATACCTGCCA 54 526 T. grayi This study
TGR-OutR TGGGGATTACGGATGAAAC
TGR-InF TTAAGGAGGCGCTCAGGTTC
TGR-InR TGTGCATATACGTCTATG
TVIV-F CTGAGTGCTCCATGTCCCAC 60 142 T. vivax [24]
TVIV-R CCACCAGAACACCAACCTGA
COI-F TTGATTTTTTGGTCATCCAGAAGT 55 900 Generic Glossina cox1 [28]
COI-R TGAAGCTTAAATTCATTGCACTAATC
  1. Abbreviations: TCON, T. congolense; TGR, T. grayi; TVIV, T. vivax; cox1, cytochrome c oxidase 1; Out, outer primer; In, inner primer; F, forward; R, reverse; TA, annealing temperature