Skip to main content

Table 1 A list of primers used for the LAMP method

From: A novel loop-mediated isothermal amplification-based test for detecting Neospora caninum DNA

Primer name Type Length Localizationa Sequence (5′–3′)
F3 Forward outer 20 73–92 TGAACCGAGGGAGTTGGTAG
B3 Reverse outer 18 269–286 ACGTCTTCTGCCCCTTCC
FIPb Forward inner 40 F1C, 140–160 ACCCTGACGCAGGCTGATTTC
BIPb Reverse inner 40 B1C, 200–221 TTCTGTGTTGAGGCAACACCGG
  (BIP = B1C + B2)   B2, 248–265 GTCCGCTTGCTCCCTATG
  1. aLocalization of the primers is based on the nucleotide sequence of N. caninum Nc-5 unique repetitive region (GenBank: AY459289.1)
  2. bEach inner primer of LAMP contains two connected primers