Skip to main content

Table 1 Oligonucleotide sequences of the primers used in this study

From: Anaplasma phagocytophilum in the highly endangered Père David’s deer Elaphurus davidianus

Pathogen Target gene Primer Amplicon size (bp) References
Primer Name Oligonucleotide sequence (5′-3′)
A. centrale 16S rRNA AC1f CTGCTTTTAATACTGCAGGACTA 426 Kawahara et al., [6]
AC1r ATGCAGCACCTGTGTGAGGT
A. bovis 16S rRNA AB1f CTCGTAGCTTGCTATGAGAAC 551 Kawahara et al., [6]
AB1r TCTCCCGGACTCCAGTCTG
A. phagocytophilum 16S rRNA SSAP2f GCTGAATGTGGGGATAATTTAT 641 Kawahara et al., [6]
SSAP2r ATGGCTGCTTCCTTTCGGTTA
A. marginale msp4 Amargmsp4 F CTGAAGGGGGAGTAATGGG 344 Torina et al., [8]
Amargmsp4 R GGTAATAGCTGCCAGAGATTCC
A. ovis msp4 Aovismsp4 F TGAAGGGAGCGGGGTCATGGG 347 Torina et al., [8]
Aovismsp4 R GAGTAATTGCAGCCAGGGACTCT
A. platys 16S rRNA Platys-F AAGTCGAACGGATTTTTGTC 504 Inokuma et al., [7]
Platys-R CTTTAACTTACCGAACC