Table 1 Oligonucleotide primer sequences used for PCR in this study
Name | Sequence (5'-3') | Description |
|---|---|---|
BmTrx2-Con-F | GCACTACACATACCCACGTATTAT | Forward primer specific for BmTrx2 conserved sequence (partial) |
BmTrx2-Con-R | TGCGTCAATTCCAGTGACAATTAC | Reverse primer specific for BmTrx2 conserved sequence (partial) |
3' GSP1 | CATAGAGACAGTGGATTGCTACAGG | Forward gene specific primer for 3'-end of BmTrx2 in primary PCR |
3' GSP2 | GAGCACAGAGTTACTACGATTCCCAT | Forward gene specific primer for 3'-end of BmTrx2 in second PCR |
5' GSP1 | CCGATTCCAACTTAGG | Gene specific primer for reverse transcription of B. microti mRNA |
5' GSP2 | GGGAATCGTAGTAACTCTGTGCTCC | Reverse gene specific primer for 5'-end of BmTrx2 in primary PCR |
5' GSP3 | GCCTTCCTGTAGCAATCCACTGTC | Reverse gene specific primer for 5'-end of BmTrx2 in second PCR |
BmTrx2-ORF-F | CATATGCATAGCATGAGTAGGGTCATATTT | Forward primer containing an NdeI site for cloning into pET30a(+)-BmTrx2 |
BmTrx2-ORF-R | CTCGAGCTTTTGAGGGGGTGTGACGTGT | Reverse primer containing a XhoI site for cloning into pET30a(+)-BmTrx2 |
BmTrx2-qRT-F | GTCTAGTGGCGTTGTTGTTGC | Forward gene specific primer for the quantification of BmTrx2 mRNA |
BmTrx2-qRT-R | GACCGATTTCATCTGATTGCTTA | Reverse gene specific primer for the quantification of BmTrx2 mRNA |
Bm18S-qRT-F | GTTATAGTTTATTTGATGTTCGTTT | Forward gene specific primer for the quantification of B. microti 18S mRNA |
Bm18S-qRT-R | AAGCCATGCGATTCGCTAAT | Reverse gene specific primer for the quantification of B. microti 18S mRNA |