Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 3 The list of primer sequences for An. atroparvus genes used as PCR-based DNA markers to hybridize with chromosomes of An. beklemishevi

From: A standard photomap of ovarian nurse cell chromosomes and inversion polymorphism in Anopheles beklemishevi

An. atroparvus gene Chromosome Forward primer Reverse primer
AATE001169 X TGGAGGACGTTCGGTTTCTG AATTCCGACTGCTCGCTAGG
AATE017741 X GCAGCTGTTATGTGCTTCGG GTAGTACACCCAGTAGCGCC
AATE010870 X CCAAATCTTCTCAATCGCCCG CGTCAAGTCGTCCTCGGAAT
AATE018256 2R AGTTGTGTACTGCATGGCGA ACGATGGTCGCATAGAGCAG
AATE009100 3R GGTGTGGTGCTGAAAATGTG CACCTACACCCAGAGGCATT
AATE008818 3L TCATGCTCGGCTGGTTCATT CGTGAATGTGGTACGCAACG