Skip to main content

Table 1 Gene-specific primers used in this study. Underlined letters indicate enzyme recognition sites. RNA polymerase promoter sequence is indicated in italic

From: Characterization and expression analysis of a newly identified glutathione S-transferase of the hard tick Haemaphysalis longicornis during blood-feeding

Primer Sequence (5′ → 3′)
HlGST real-time forward CTTCTTGGATCTTGGCGGGT
HlGST real-time reverse CGATGTCCCAGTAGCCGAG
HlGST BamHI forward CGGGATCCATGGCTCCTATTCTCGGCT
HlGST EcoRI reverse CGGAATTCTCAGCAGTCGTCAGCGGGCG
HlGST RT forward ACGTGAAGCTCACCCAGAGCAT
HlGST RT reverse AAGCTAGCCATGTCGCCGTTGA
HlGST RNAi forward GCCTGGCTCAAGGAGAAACACA
HlGST RNAi reverse ACAAAGGCCTTCAGGTTGGGGA
HlGST T7 forward TAATACGACTCACTATAGGGCCTGGCTCAAGGAGAAACACA
HlGST T7 reverse TAATACGACTCACTATAGGACAAAGGCCTTCAGGTTGGGGA
HlGST2 real-time forward CCCTTCCGGGAATGAAGGAG
HlGST2 real-time reverse GATCGCTCAGCAGTCGTCAG
HlGST2 BamHI forward CGGGATCCATGGCCCCTGTGCTGGGATA
HlGST2 EcoRI reverse CGGAATTCTCAGCAGTCGTCAGCGGGCG
HlGST2 RT forward ACGTCAAGCTGACGCAGAGCAT
HlGST2 RT reverse ATGGGCCAAGCCTTGAAGCGAT
HlGST2 RNAi forward AGGATAAAAGGTACGGCTTCGGCA
HlGST2 RNAi reverse TTTCACGATCTGGAGAGCCTCGTA
HlGST2 T7 forward TAATACGACTCACTATAGGAGGATAAAAGGTACGGCTTCGGCA
HlGST2 T7 reverse TAATACGACTCACTATAGGTTTCACGATCTGGAGAGCCTCGTA
P0 real-time forward CTCCATTGTCAACGGTCTCA
P0 real-time reverse TCAGCCTCCTTGAAGGTGAT
L23 real-time forward CACACTCGTGTTCATCGTCC
L23 real-time reverse ATGAGTGTGTTCACGTTGGC
Actin real-time forward ATCCTGCGTCTCGACTTGG
Actin real-time reverse GCCGTGGTGGTGAAAGAGTAG
Actin RT forward CCAACAGGGAGAAGATGACG
Actin RT reverse ACAGGTCCTTACGGATGTCC
Tubulin real-time forward TTCAGGGGCCGTATGAGTAT
Tubulin real-time reverse TGTTGCAGACATCTTGAGGC
EGFP T7 forward TAATACGACTCACTATAGGGACGTAAACGGCCACAAGTT
EGFP T7 reverse TAATACGACTCACTATAGGTGCTCAGGTAGTGGTTGTCG