Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers used for the amplification of five DNA regions

From: Identification and genetic characterization of Sarcocystis arctica and Sarcocystis lutrae in red foxes (Vulpes vulpes) from Baltic States and Spain

DNA region Primer name Primer sequence (5′-3′) Reference
18S rDNA SarAFa CTGGTTGATCCTGCCAGTAG [30]
SarBRb GGCAAATGCTTTCGCAGTAG [30]
SarCFa TTTAACTGTCAGAGGTGAAATTCTT [30]
SarDRb GCAGGTTCACCTACGGAAA [30]
28S rDNA KL-P1Fa TACCCGCTGAACTTAAGCAT [30]
KL-P2Rb TGCTACTACCACCAAGATCTGC [30]
ITS1 P-ITSFa ATTACGTCCCTGCCCTTTGT [30]
P-ITSRb GCCATTTGCGTTCAGAAATC [30]
cox1 SF1a ATGGCGTACAACAATCATAAAGAA [31]
SR5b ATATCCATACCTCCATTGCCCAT [31]
rpoB RPObFa TAGTACATTAGAAATCCCTAAAC [32]
RPObRb TCWGTATAAGGTCCTGTAGTTC [32]
  1. aForward primer
  2. bReverse primer