Skip to main content

Advertisement

Table 1 Sequences of the oligonucleotides used in EMSA experiments

From: The Entamoeba histolytica TBP and TRF1 transcription factors are GAAC-box binding proteins, which display differential gene expression under different stress stimuli and during the interaction with mammalian cells

Oligonucleotide Sequence (5′-3′)
TATTTAAA (1) AATTCTCTATTTAAAGAGAATT
TAgTgAAA (2) AATTCTCTAgTgAAAGAGAATT
TATTggAA (3) AATTCTCTATTggAAGAGAATT
TATTaAAA (4) AATTCTCTATTaAAAGAGAATT
TATgTAAA (5) AATTCTCTATgTAAAGAGAATT
gAgTTAAA (6) AATTCTCgAgTTAAAGAGAATT
TAcTcAAA (7) AATTCTCTAcTcAAAGAGAATT
cAcTcAAA (8) AATTCTCcAcTcAAAGAGAATT
cAcTTAAA (9) AATTCTCcAcTTAAAGAGAATT
TATTTttt (10) AATTCTCTATTTtttGAGAATT
GAAC-box (Wild type) AAGACAATGAACTAGAATG
GAAC-boxa (Mutated) AAGACCTACGATAAGAATG
GAAC-like boxb AGGCGAACTACAAAAGAT
  1. aWild type and mutated GAAC-boxes are identical to those reported for hgl5 gene [33]
  2. bThis box was previously reported [17]