Table 3 Details of predicted new miRNAs by the bioinformatic approach
From: Analysis of microRNA profile of Anopheles sinensis by deep sequencing and bioinformatic approaches
Name | Source miRNA | Source organism | Mature sequence | Strand | Minimum free energy values (kcal/mol) | Coordinates in genome |
|---|---|---|---|---|---|---|
asi-miR-9383 | dme-miR-9383 | Drosophila melanogaster | GGGUUCAGGUUGAAGGCAAACU | 5' | -24.2 | KE525292.1:9200–9260 |
asi-miR-2a-2 | dme-miR-2a-2 | Drosophila melanogaster | UAUCACAGCCAGCUUUGAUGAGC | 5' | -29.5 | KE525350.1:1783756–1783828 |