Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 3 Details of predicted new miRNAs by the bioinformatic approach

From: Analysis of microRNA profile of Anopheles sinensis by deep sequencing and bioinformatic approaches

Name Source miRNA Source organism Mature sequence Strand Minimum free energy values (kcal/mol) Coordinates in genome
asi-miR-9383 dme-miR-9383 Drosophila melanogaster GGGUUCAGGUUGAAGGCAAACU 5' -24.2 KE525292.1:9200–9260
asi-miR-2a-2 dme-miR-2a-2 Drosophila melanogaster UAUCACAGCCAGCUUUGAUGAGC 5' -29.5 KE525350.1:1783756–1783828