Skip to main content

Table 1 Primers and protocols used for the amplification of feline hemoplasmas and housekeeping GAPDH gene control

From: Epidemiological study of hemotropic mycoplasmas (hemoplasmas) in cats from central Spain

Target gene Product size (bp) PCR primers (5′–3′) PCR conditions
16S rRNA hemoplasmas [8] 170 / 193 F: ACGAAAGTCTGATGGAGCAATA 94 °C, 1 min; 45 cycles [94 °C, 1 min; 65 °C, 1 min; 72 °C, 30 s]; 72 °C, 10 min
R: ACGCCCAATAAATCCGRATAAT
CMt [11] 138 F: AGAGGCGAAGGCGAAAACT 95 °C, 2 min; 30 cycles [95 °C, 10 s; 58 °C, 30 s; 72 °C, 30 s]; 72 °C 5 min
R: CTACAACGCCGAAACACAAA
GAPDH-Housekeeping [22] 282 F: CCTTCATTGACCTCAACTACAT 95 °C, 1 min; 45 cycles [94 °C, 4 s; 57 °C, 4 s; 72 °C, 3 s]; 72 °C, 1 min
R: CCAAAGTTGTCATGGATGACC
  1. Abbreviations: CMtCandidatus Mycoplasma turicensis”, GAPDH gliceraldehide-3-phosphate dehydrogenase