Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Details regarding target species, amplified DNA fragment, positive control used in PCR and references

From: Molecular survey of neglected bacterial pathogens reveals an abundant diversity of species and genotypes in ticks collected from animal hosts across Romania

Target species Target sequence Primer sequences (5'-3'); forward, reverse and, where applicable, probe Positive control Reference
Rickettsia spp. gltA for: ATAGGACAACCGTTTATTT;
rev: CAAACATCATATGCAGAAA;
probe: FAM-CCTGATAATTCGTTAGATTTTACCG-TMR
DNA extract from positive cell culture of R. monacensis (own isolate) [20]
Anaplasma spp.; Ehrlichia spp.; “Ca. N. mikurensis” 16S rRNA for: GGGGATGATGTCAARTCAGCAY;
rev: CACCAGCTTCGAGTTAAGCCAAT
DNA-extract from an A. phagocytophilum-positive I. ricinus [22]
Bartonella spp. ssrA for: CTATGGTAATAAATGGACAATGAAATAA;
rev: GCTTCTGTTGCCAGGTG
DNA-extract from B. grahamii- positive rodent blood [24]
Francisella spp. tul4 for: ATTACAATGGCAGGCTCCAGA;
rev: TGCCCAAGTTTTATCGTTCTTCT;
probe: FAM-TTCTAAGTGCCATGATACAAGCTTCCCAATTACTAAG-BBQ
Francisella tularensis holarctica Live Vaccine Strain (LVS = ATCC 29684 [25]
Coxiella spp. IS111, icd, com1 IS1-for: CB_A2k: TCACATTGCCGCGTTTACT;
IS1-rev: CBA_2k: TCACATTGCCGCGTTTACT;
IS1-probe: Red640-TAATCACCAATCGCTTCGTCCCGGT; icdtrg_f: CGGAGTTAACCGGAGTATCCA;
icdtrg_r: CCGTGAATTTCATGATGTTACCTTT;
comtrg_f: CCCTGCAATTGGAACGAAG;
comtrg_r: GTTCTGATAATTGGCCGTCGACA
DNA extract from cell cultured reference strain NineMile RSA 493 [26, 27]
  1. Abbreviations: for forward, rev reverse