Skip to main content

Table 1 Primer sequences, sizes of PCR amplicons and annealing temperature of the amplification of pfap2mu and pfubp1 genes

From: Prevalence of Plasmodium falciparum delayed clearance associated polymorphisms in adaptor protein complex 2 mu subunit (pfap2mu) and ubiquitin specific protease 1 (pfubp1) genes in Ghanaian isolates

Gene Primers (5'–3') Size of PCR amplicon (bp) Annealing temperature (°C)
pfap2mu Primary amplification 2247 50
Forward: AAGACTGTCAAATGTAAAAGACCC
Reverse: CTCATGTAAAACAAAAAGTGAGG
Secondary amplification 841 52
Forward: GATATCCACAAACATTAGAAGTG
Reverse: CCATCTGGTGGTGTGAAGG
pfubp1 Primary amplification 484 52
Forward: CGCCCGTACTATGAAGAAGATC
Reverse: GGCTTTTACCTGAACTGTTCAGG
Secondary amplification 304 57
Forward: CGTAAACAGAATATTCAGGATTGC
Reverse: CTAGCCCTTTATTATCATTATCG