Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer sequences and locus characteristics

From: Development of polymorphic EST microsatellite markers for the sand fly, Phlebotomus papatasi (Diptera: Psychodidae)

Locus Accession no. Repeat Fragment size (bp) Forward (5'-3')a Reverse (5'-3') Tm (°C)b Genec
PPEST 2 FG10856.1 (GCA)13 141 D2-TGTCAATAGTGGCTCAATGCTC ATTAGTCGTTTATCCTTCCCCG 60 PPAI004876-PA
PPEST 10 FG117371.1 (TC)12 236 D2-ACTGAATCTTCTGCTTTCTCCATTC TAAGGGAAGGGGCGGAAC 60 PPAI001073-PA
PPEST 11 ES347986.1 (GA)11 162 D4-GGTGGATACTTGTGACGACTGA CCACTCAAACTAAACTGGAAAGC 60 PPAI005664-PA
PPEST 17 FG116712.1 (TGC)9 208 D4-CTGTTCAGCAAAACGAGACG TCCCAAGTACAAAGACGGAACT 60 PPAI008660-PA
PPEST 33 FG115100.1 (GAA)15 251 D4-ATACTCCCTCAGAACTAGCCCC TTCGTCTTCTTCTTCTTCCTCC 60 PPAI005234-PA
PPEST 34 EY215687.1 (AAAG)5 137 D3-CACCTACAGAGATGCTGGATTG GGGCTAAAATGTGTCTTGACTTG 62 PPAI003756-PA
PPEST 40 FG114532.1 (AG)5 322 D2-TCCCAAGGCTATTAAGTCTGGT GGCTATCGTGCAATTTTCTTCT 62 PPAI005295-PA
PPEST43 EX474024.1 (CT)8 228 D3-AAAAGAGATTTTCGGGGAAGG GATTGTTGAAGGAGTGAAAGGG 62 PPAI008911-PA
PPEST49 FG114549.1 (AG)10 171 D2-AAACAGCTTCAATCGCTCTGAC CTCACTCACTCTCCCTTCGTCT 60 PPAI001715-PA
PPEST68B ES349040.1 (CA)6 195 D3-TGATTTCACCCTTGTGTTTCC TGTGGCAACTTATTTACATCCC 57.1 PPAI009554-PA
PPEST73 EY213549.1 (GA)7 244 D3-CCAACAATCTCCTCTCTATCGC CCCTCAAGCTAACAAACACACA 57.1 PPAI009131-PA
PPEST75 EY203801.1 (GTT)5 237 D4-TTGTCAGGAAAGGAGTTGTTCA GTATGCAGCTCTCCCAGAAGAT 55.5 PPAI006509-PA
PPEST77 EY204214.1 (GA)8 181 D2-AATCTCAATCTGGGCAATGTGT ACCTTCTCTGTAAATTCCCTTGG 57.1 PPAI004565-PA
PPEST85 EY208767.1 (GA)9 244 D4-GTTGAAGGGAAATTGTGAGGAT ATGGACATTTGTGGACTCTGC 60 PPAI003566-PA
  1. aForward primer labeled with either D2, D3, or D4 fluorescent dye at 5' end
  2. bAnnealing temperature
  3. cGene code based on full P. papatasi genome assembly (available at www.vectorbase.org