Skip to main content

Table 1 Primer sequences, annealing temperatures and the fragment lengths of the genes used in this study

From: First identification and multilocus genotyping of Giardia duodenalis in pet chipmunks (Eutamias asiaticus) in Sichuan Province, southwestern China

Gene Primer Sequence (5'-3') Annealing temperature (°C) Fragment length (bp) Reference
bg F1 AAGCCCGACGACCTCACCCGCAGTGC 65 530 [21]
R1 GAGGCCGCCCTGGATCTTCGAGACGAC
F2 GAGGCCGCCCTGGATCTTCGAGACGAC 65
R2 CATAACGACGCCATCGCGGCTCTCAGGAA
tpi F1 AAATIATGCCTGCTCGTCG 50 530 [21]
R1 CAAACCTTITCCGCAAACC
F2 CCCTTCATCGGIGGTAACTT 50
R2 GTGGCCACCACICCCGTGCC
gdh F1 TTCCGTRTYCAGTACAACTC 50 511 [21]
R1 ACCTCGTTCTGRGTGGCGCA
F2 ATGACYGAGCTYCAGAGGCACGT 50
R2 GTGGCGCARGGCATGATGCA