Skip to main content

Table 1 PCR and qPCR primers

From: History, epidemiology and diagnostics of dengue in the American and Brazilian contexts: a review

Reference Sequence Primer name Set Size (bp) Target
Lanciotti et al. [33] Region (C-prM) TCAATATGCTGAAACGCGCGAGAAACCG D1 D1-D2 511 DENV-all
TTGCACCAACAGTCAATGTCTTCAGGTTC D2
CGTCTCAGTGATCCGGGGG TS1 D1-TS1 482 DENV-1
CGCCACAAGGGCCATGAACAG TS2 D1-TS2 119 DENV-2
TAACATCATCATGAGACAGAGC TS3 D1-TS3 290 DENV-3
CTCTGTTGTCTTAAACAAGAGA TS4 D1-TS4 392 DENV-4
Chow et al. [34] Region (NS3) GGRACKTCAGGWTCTCC upstream up-down 490 DENV-all
AARTGIGCYTCRTCCAT downstream
Chang et al. [35] Region (NS5) TTTGAGCATGTCTTCCGTCGTCATCC Bio-CFD2-4 FUD-CFD2-4 or FUD-CFDJ 838 or 832 DENV-all
GCATGTCTTCCGTCGTCATCC Bio-CFDJ9977
GATGACACAGCAGGATGGGAC FUDJ9166
GCCTGAACATGCTCTATTGGCT DEN1-J9243 DEN1-CFD2 761 DENV-1
TCTTCAAAAGCATTCAGCACCT DEN2-J9452 DEN2-CFD2 546 DENV-2
CCCATCCGCTAGAGAAGAAAATTACAC DEN3-9471 DEN3-CFD2 522 DENV-3
GGTTTGGCACTTCCCTCCTCTTCTTG DEN4-9580 DEN4-CFD2 411 DENV-4
Pierre et al. [37] Region (NS5/3'NC) TGGATGACGACGGAAGACATG EMF1 EMF1-VD8 600 DENV-all
GGGTCTCCTCTAACCTCTAG VD8
Meiyu et al. [38] Region (NS1) GACATGGGGTATTGGAT DJS DJS-DJA 413 DENV-all
TCCATCCCATACCTGCA DJA
ATGGATTACCAATATCT DEN1 DEN1-DJA 262 DENV-1
GTAAGCTTGAGATGGAC DEN2 DEN2-DJA 189 DENV-2
AGCCAAAAGAATGGAAG DEN3 DEN3-DJA 392 DENV-3
CTGCATCTGGAAAACTA DEN4 DEN4-DJA 97 DENV-4
Kuno et al. [39] Region (NS5) TCAAGGAACTCCACACATGAGATGTACT FG1-F FG1-G4 1991 FLAV
CCAGATGTTCTTWGCCCAYTCTGC G4-R
TACAACATGATGGGAAAGAGAGAGAA FU1-F FU1-cFD3 1084 FLAV
AGCATGTCTTCCGTGGTCATCCA cFD3-R)
GTGTCCCAGCCGGCGGTGTCATCAGC cFD2 (R) FU1-cFD2 220 FLAV
Shu et al. [40] Region (C) CAATATGCTGAAACGCGAGAGAAAC DN-F DNF-DNR 170 DENV-all
CCCCATCTATTCAGAATCCCTGCTC DN-R
CGCTCCATACATCTTGAATGAGC D1-R DNF-D1R 190 DENV-1
AAGACATTGATGGCTTTTGAC D2-R DNF-D2R 203 DENV-2
AAGACGTAAATAGCCCCCGACC D3-R DNF-D3R 201 DENV-3
AGGACTCGCAAAAACGTGATGAATC D4-R DNF-D4R 133 DENV-4
Johnson et al. [41] Region (M/E/NS5) CAAAAGGAAGTCGTGCAATA DEN-1 F FAM/BHQ-1 111 DENV1
CTGAGTGAATTCTCTCTACTGAACC DEN-1 C
CATGTGGTTGGGAGCACGC DEN-1 probe
CAGGTTATGGCACTGTCACGAT DEN-2 F HEX/BHQ-1 605 DENV2
CCATCTGCAGCAACACCATCTC DEN-2 C
CTCTCCGAGAACAGGCCTCGACTTCAA DEN-2 probe
GGACTGGACACACGCACTCA DEN-3 F TR/BHQ-2 73 DENV3
CATGTCTCTACCTTCTCGACTTGTCT DEN-3 C
ACCTGGATGTCGGCTGAAGGAGCTTG DEN-3 probe
TTGTCCTAATGATGCTGGTCG DEN-4 F Cy5/BHQ-3 88 DENV4
TCCACCTGAGACTCCTTCCA DEN-4 C
TTCCTACTCCTACGCATCGCATTCCG DEN-4 probe
Ayers et al. [43] Region (NS5) AATGTACGCTGATGACACAGCTGGCTGGGACAC FLAVI-1 FLAVI1-FLAVI2 863 FLAV
TCCAGACCTTCAGCATGTCTTCTGTTGTCATCCA FLAVI-2
Chien et al. [44] Region (C-prM) TCAATATGCTGAAACGCGAGAGAAACCG mD1 mD1-D2 511 DENV-all
TTGCACCAACAGTCAATGTCTTCAGGTTC D2
CCCGTAACACTTTGATCGCT rTS1 mD1-rTS1 208 DENV-1
CGCCACAAGGGCCATGAACAGTTT mTS2 mD1-mTS2 119 DENV-2
TAACATCATCATGAGACAGAGC TS3 mD1-TS3 288 DENV-3
TTCTCCCGTTCAGGATGTTC Rts4 mD1-rTS4 260 DENV-4
Chien et al. [44] Region (NS5) TACAACATGATGGGAAAGCGAGAGAAAAA mFU1 mFU1-CFD2 220 FLAV
GTGTCCCAGCCGGCGGTGTCATCAGC CFD2
TCAGAGACATATCAAAGATTCCAGGGGG D1P FAM/BHQ1 220 DENV-1
AAGAGACGTGAGCAGGAAGGAAGGGGGAGC D2P Texas Red/BHQ2 220 DENV-2
TGAGAGATATTTCCAAGATACCCGGAGGAG D3P CY5/BHQ3 220 DENV-3
TGGAGGAGATAGACAAGAAGGATGGAGACC D4P HEX/BHQ1 220 DENV-4
Salles et al. [42] Region (C-prM) TTTATTTAGAGAGCAGATCTCTG STD STD-D2 572 DENV-all
TTGCACCAACAGTCAATGTCTTCAGGTTC D2
ACGGGTCGACCGTCTTTCAA STD1 STD1-rTS1 225 DENV-1
CCCGTAACACTTTGATCGCT rTS1
GCGAAAAACACGCCTTTCAA STD2 STD2-mTS2 140 DENV-2
CGCCACAAGGGCCATGAACAGTTT mTS2
ACGGGAAACCGTCTATCAA STD3 STD3-TS3 302 DENV-3
TAACATCATCATGAGACAGAGC TS3
GTGGTTAGACCACCTTTCAA STD4 STD4-rTS4 282 DENV-4
TTCTCCCGTTCAGGATGTTC rTS4