Skip to main content

Table 1 Sequences of oligonucleotide primers used for real-time PCR

From: Toxoplasma gondii dense granule protein 15 induces apoptosis in choriocarcinoma JEG-3 cells through endoplasmic reticulum stress

Target Forward primer (5'-3') Reverse primer (5'-3') Product size (bp)
Caspase 3 GACAGACAGTGGTGTTGATG TGGATGAACCAGGAGCCATC 132
Caspase 8 AACCTGGTACATCCAGTCAC AAAGTAGGCTGAGGCATCTG 150
Caspase 9 AAGGTTTGAGGACCTTCGAC GACTGCAGGTCTTCAGAGTG 184
Caspase 4 GTGGAGAAGGACTTCATTGC CTGGAAGCATGTGATGAGTTG 108
ATF4 CAGCTACCACCCATAACAAG GTGTCCATCACCTGACAGTC 138
ATF6 CAGCTACCACCCATAACAAG GTGTCCATCACCTGACAGTC 133
GRP78 GTCCTTCTATGAAGGAGAAG GAATCTTCCAACACTTTCTGG 117
CHOP TGCAAGAGGTCCTGTCTTCAG GCACTGACTCCTCGGAAC 106
XBP1 AAGGCGCTGAGGAGGAAAC GGTTCTCAACTACAAGGCC 178
GAPDH CTTCATTGACCTCAACTACATGG CTCGCTCCTGGAAGATGGTGAT 134
  1. Abbreviations: ATF activating transcription factor, GRP78 78-kDa glucose-regulated protein, CHOP C/EBP homologous protein, XBP1 X-box binding protein-1, GAPDH glyceraldehyde-3-phosphate dehydrogenase