Skip to main content

Table 1 Primer sequences, lengths of PCR amplicons and annealing temperatures

From: Echinococcus multilocularis and Echinococcus shiquicus in a small mammal community on the eastern Tibetan Plateau: host species composition, molecular prevalence, and epidemiological implications

Primers Original code Species Target genes Primer sequences Amplicon length (bp) Annealing temperature (°C) Reference
CO1JP2 COIF Taeniidae gen. sp. cox1 TTGAATTTGCCACGTTTGAATGC 875 52 [26]
COIR GAACCTAACGACATAACATAATGA
ND1Em EmF19/3 E. multilocularis nad1 TAGTTGTTGATGAAGCTTGTTG 207 53 [27]
EmR6/1 ATCAACCATGAAAACACATATACAAC
ND1Es EsF50 E. shiquicus nad1 TTATTCTCAGTCTCGTAAGGGTCCG 442 60 [27]
EsR73 CAATAACCAACTACATCAATAATT
ND1Eg Eg1F81 E. granulosus nad1 GTTTTTGGCTGCCGCCAGAAC 226 62 [27]
Eg1R83 AATTAATGGAAATAATAACAAACTTAATCAACAAT