Skip to main content

Advertisement

Table 1 Primer and probe selections following RT-PCR melt curve screening

From: Development of a rapid field-applicable molecular diagnostic for knockdown resistance (kdr) markers in An. gambiae

Primer/probe Sequence (5'–3')
1014 Forward primer TCCCCGACCATGATCTGCCAA
1014 Reverse primer GCACCTGCAAAACAATGTCATGTAA
1014 Probe MGGAAATTTTGTCGFAAGTAAFGCAAP
1575 Forward primer AAAGAAAGCTGGTGGATCGC
1575 Reverse primer TGAAAACACTAACCCTTGGACGA
1575 Probe MTATTATGCAAFGAAAAAAAFGGGTP
  1. F, M and P (in bold) denote a fluorescein labelled deoxythymidine base, a trimethoxystilbene and propanol conjugate, respectively.