Skip to main content

Table 1 Primary and secondary PCR primers for Plasmodium species

From: Plasmodium falciparum msp1 and msp2 genetic diversity and allele frequencies in parasites isolated from symptomatic malaria patients in Bobo-Dioulasso, Burkina Faso

PCR round Primer name Primer sequence (5'-3')
Primary PCR rPLUf TTAAAATTGTTGCAGTTAAAACG
rPLUr CCTGTTGTTGCCTTAAACTTC
Nested PCR species rFALf TTAAACTGGTTTGGGAAAACCAAATATATT
rFALr ACACAATGAACTCAATCATGACTACCCGTC
rMALf ATAACATAGTTGTACGTTAAGAATAACCGC
rMALr AAAATTCCCATGCATAAAAAATTATACAAA
rVIVf CGCTTCTAGCTTAATCCACATAACTGATAC
rVIVr ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA
rOVAf ATCTCTTTTGCTATTTTTTAGTATTGGAGA
rOVAr GGAAAAGGACACATTAATTGTATCCTAGTG