Skip to main content

Table 2 Primers sequences, cycling conditions and annealing temperature for msp1 and msp2 PCR

From: Plasmodium falciparum msp1 and msp2 genetic diversity and allele frequencies in parasites isolated from symptomatic malaria patients in Bobo-Dioulasso, Burkina Faso

Gene PCR round Primer name Sequence (5'-3') Cycling conditions Allelic family (annealing temperature) Positive control
msp1 Primary M1-OF: CTAGAAGCTTTAGAAGATGCAGTATTG Initial denaturation: 95 °C for 5 min; PCR: 25 cycles of 94 °C for 1 min, 61 °C for 45 s, 72 °C for 1.5 min; final elongation:72 °C for 5 min 61 °C  
M1-OR: CTTAAATAGTATTCTAATTCAAGTGGATCA
Secondary M1- KF: AATGAAGAAGAAATTACTACAAAAGGTGC Initial denaturation: 95 °C for 5 min; PCR: 30 cycles of 94 °C for 45 s, allele-specific °C for 30s, 72 °C for 1 min; final elongation: 72 °C for 5 min K1(61 °C) 3D7
M1-KR: GCTTGCATCAGCTGGAGGGCTTGCACCAGA
M1-MF: AAATGAAGGAACAAGTGGAACAGCTGTTAC MAD20 (61 °C) HB3
M1-MR: ATCTGAAGGATTTGTACGTCTTGAATTACC
M1-RF: TAAAGGATGGAGCAAATACTCAAGTTGTTG R033 (63 °C) R033
M1-RR: CATCTGAAGGATTTGCAGCACCTGGAGATC
msp2 Primary MSP2-1: ATGAAGGTAATTAAAACATTGTCTATTATA Initial denaturation: 94 °C for 5 min; PCR: 40 cycles of 94 °C for 1.5 min, 55 °C for 45 s, 72 °C for 1.5 min; final elongation: 72 °C for 10 min (55 °C)  
MSP2-4: ATATGGCAAAAGATAAAACAAGTGTTGCTG
Secondary A1: GCAGAAAGTAAGCCTTCTACTGGTGCT Initial denaturation: 94 °C for 2 min; PCR: 30 cycles of 94 °C for 1.5 min, 55 °C for 45 s, 72 °C for 1.5 min; final elongation: 72 °C for 10 min IC/3D7 (55 °C) 3D7
3D7 A2: GATTTGTTTCGGCATTATTATGA
FC27 B1: GCAAATGAAGGTTCTAATACTAATAG FC27 (55 °C) HB3
FC27 B2: GCTTTGGGTCCTTCTTCAGTTGATTC