Skip to main content

Table 2 Primer sequence, repeat motif, no. of alleles, inbreeding coefficient, Hardy-Weinberg test, and neutrality test of each locus

From: Genetic differentiation of the oriental rat flea, Xenopsylla cheopis, from two sympatric host species

Locus Primer sequence (5'→3') Repeat motif No. of alleles F IS Hardy-Weinberg test Neutrality test
Forward Reverse H o H e P F o L95 U95
P5 TATACCAAATTTCACACAGTT ATATTCTTAGGAATCCCAGTT (CT)12 4 0.1251 0.4216 0.6197 < 0.0001 0.3834 0.3212 0.9424
P6 TTAATAGGCATATAATTCAAA GAATTCCCATCACAACCCATA (CT)10 7 0.3581 0.1863 0.3282 < 0.0001 0.6734 0.2241 0.7653
P12 TGACTTCCGTGTATCACTAAC CTAAGGACAAATAAATATGCC (AG)9 6 01829 0.3922 0.6403 < 0.0001 0.3628 0.2389 0.8439
P15 CCATTTTTCGTACCTGCTACC GTCAAGAAGAGGACTCGCTGA (TC)5(TC)4 5 0.6273 0.1275 0.4329 < 0.0001 0.5693 0.2786 0.9051
P19 TTGGTGAGATATAAGTGTGTG CAAGAAATTGATAACATTTTC (TC)20 12 0.2313 0.5000 0.8154 < 0.0001 0.1886 0.1419 0.5329
P21 GATCAGGTGTTTCGAGTTATC TTATTATATATGCTCTTGCGC (CT)13...(TC)6 5 0.3796 0.2647 0.4430 < 0.0001 0.5592 0.2656 0.8964
P24 AAAAATTGTCGAAAGAAGACA TTAGAGAAATCGTTGAGGAAA (GT)7 4 -0.1344 0.3824 0.5014 0.0007 0.5011 0.3287 0.9518
P27 TCATACTAAAATTGAAGAAGG ACGTAAATACGAATCGAACAC (TG)6 7 -0.2196 0.5588 0.5143 < 0.0001 0.4882 0.2159 0.8001
P29 TGAATTAGAGTTGCCAAACGG AATTCGCATAACAATCGCCTA (GT)3...(GT)6 2 0.0855 0.1863 0.2011 0.6090 0.7999 0.5048 0.9902
P33 ATAAGGAAGTAACCAAAAGGG TCATCAACAATCAAAACGAAG (TG)6 2 0.0636 0.3137 0.4090 0.0271 0.5930 0.5024 0.9902
P36 GTGAGGTTCAAAGTCGGGTAT AATAAAAATCGGTTCAGCAGT (TG)8 7 0.1668 0.4706 0.6047 0.0006 0.3983 0.2155 0.7537
  1. Abbreviations: F IS inbreeding coefficient, H o observed heterozygosity, H e expected heterozygosity, F o observed frequency, L95 95% lower boundary of F o , U95, 95% upper boundary of F o