Skip to main content

Advertisement

Table 2 Primers used for PCR detection of hemoparasites in wild Neotropical, Indo-Malayan and Australasian Psittaciformes

From: Can the intake of antiparasitic secondary metabolites explain the low prevalence of hemoparasites among wild Psittaciformes?

Gene Primer name Primer sequence 5’→3’ Size (bp) Annealing Parasite
Cytochrome b Palu-Fq CAAGGTAGCTCTAATCCTTTAGG 201 54 °C / 30 s Haemoproteus; Plasmodium
Palu-R DGGAACAATATGTARAGGAGT
Cytochrome b L180 GAGAACTATGGAGTGGATGG 221 60 °C / 30 s Leucocytozoon
Leunew1-R CCCAGAAACTCATTTGWCC
18S rRNA Try-F GGAGAGGGAGCCTGAGAAATA 121 60 °C / 30 s Trypanosoma
Try-R ATGCACTAGGCACCGTCG
18S rRNA NF110 GCTAATACATGCACCAAAGCTCC 119 60 °C / 30 s microfilaria
NR228 CAAGACCATGCGATCAGC