Skip to main content

Table 2 Targets and details of primers used for qPCR

From: Antibody and cytokine response to Cystoisospora suis infections in immune-competent young pigs

Gene Accession number Primer sequence 5′-3′ Product size (bp) Annealing temp. (°C) Primer conc. (nM) Primer efficiency (%) Source
RPL4a XM_005659862.1 F: ATGCAAAGACAATGCGCCGA 127 60 400 101.7 This study
R: ACGGGCTTCTTGTCTGGAAC
OAZ1a NM_001122994.1 F: CAATAGCTGCCTCTACATCGA 134 60 400 100.2 [27]
R: GGTTCTTGTGGAAGCAAATGAAG
IFN-ɣ NM_213948 F: GCTCTGGGAAACTGAATGAC 167 60 300 103.9 [75]
R: TCTCTGGCCTTGGAACATAG
IL-12p35 NM_213993.1 F: CATGTGTCCGCTGCGCAACCT 98 69 250 99.5 [53]
R: GCTGTGGTTGCAGGGAGGCTC
IL-2 NM_213861 F: GCCATTGCTGCTGGATTTAC 159 62 200 105.0 [75]
R: CCCTCCAGAGCTTTGAGTTC
TNF-α NM_214022 F: ACTGCACTTCGAGGTTATCGG 118 60 300 98.9 [76]
R: GGCGACGGGCTTATCTGA
IL-1β NM_001005149 F: AGAAGAGCCCATCGTCCTTG 139 60 300 99.5 [75]
R: GAGAGCCTTCAGCTCATGTG
IL-27 EST BP439244 F: GCCCGCCACTTTGCTGAATC 152 60 300 94.7 [75]
R: GGGCGAAGTGTCATGGAGAG
IL-6 NM_214399 F: ATCAGGAGACCTGCTTGATG 177 60 300 101.7 [75]
R: TGGTGGCTTTGTCTGGATTC
IL-4 NM_214123.1 F: CAACCCTGGTCTGCTTACTG 173 60 300 91.9 [77]
R: CTTCTCCGTCGTGTTCTCTG
IL-10 NM_214041 F: CCGAAGGCAGAGAGTGATGGG 111 60 300 103.9 [78]
R: ACAGGGCAGAAATTGATGACAGC
TGF-β NM_214015 F: GAAGCGCATCGAGGCCATTC 162 60 300 104.9 [75]
R: GGCTCCGGTTCGACACTTTC
  1. aReference genes for normalization
  2. Abbreviations: F forward, R reverse, RPL4 ribosomal protein L4, OAZ ornithine decarboxylase antizyme, IFN interferon, IL interleukin, TGF transforming growth factor