Skip to main content

Table 1 Sequences of primers used in RT-qPCR

From: Host-parasite interaction: changes in human placental gene expression induced by Trypanosoma cruzi

Gene Forward primer Reverse primer
TLR2 TCGGAGTTCTCCCAGTGTTTG GCAGTGAAAGAGCAATGGGC
TLR4 GGTCAGACGGTGATAGCGAG TTTAGGGCCAAGTCTCCACG
TLR7 TCCATGCCATCAAGAAAGTTGA GTCTGTGCAGTCCACGATCA
TLR9 CAGCATGGGTTTCTGCCG GGGCAGTTCCACTTGAGGTT
NOD1 CCTGGTGGCCAAGTGATTGTA CCAAGCCTGCGATTCCCATA
NOD2 ATCCGGAGCCTGTACGAGAT CGCGCAAATACAGAGCCTTG
IL-1β CTTCGAGGCACAAGGCACAA CTGGAAGGAGCACTTCATCTGT
IL6 ACCCCCAATAAATATAGGACTGGA CGAAGGCGCTTGTGGAGAA
IL-12α GCTCCAGAAGGCCAGACAAA GCCAGAGCCTAAGACCTCAC
IFN-ɣ TGGAAAGAGGAGAGTGACAGA CTGTTTTAGCTGCTGGCGAC
IL-10 CGAGATGCCTTCAGCAGAGT GGCAACCCAGGTAACCCTTA
TGFβ TACCTGAACCCGTGTTGCTC CCGGTAGTGAACCCGTTGAT
IL-17 TGGAATCTCCACCGCAATGA GCTGGATGGGGACAGAGTTC
GAPDH AACAGCGACACCCACTCCTC GGAGGGGAGATTCAGTGTGGT