Skip to main content

Advertisement

Table 2 Primer sequences used in this study based on the amino acid permease 3 (aap3) coding sequence, for amplicon 1 (Amp1), amplicon 2 (Amp2) and amplicon 3 (Amp3)

From: Amino acid permease 3 (aap3) coding sequence as a target for Leishmania identification and diagnosis of leishmaniases using high resolution melting analysis

Name Sequence (5'-3') Length (bp) Orientation Amplicon size (bp)
AAP3-Amp1-F ATCCGCTACGTCTCCGCCATCGG 23 Forward 123
AAP3-Amp1-R CGTGGTGAAGTACTTCATGTCGC 23 Reverse
AAP3-Amp2-F GCCGTCGATAAACACCCGAGC 21 Forward 131
AAP3-Amp2-R AAGCGGAAGATGATGTTGCGCCC 23 Reverse
AAP3-Amp3-F GGCGGTCGCCTACATCAGCG 20 Forward 140
AAP3-Amp3-R CGGGCACCATGAACACGAGCCATA 24 Reverse