Skip to main content

Table 1 Details of the primers used in this study

From: Molecular survey of piroplasm species from selected areas of China and Pakistan

Primer Name Sequence (5'-3') Product size (bp) Annealing T (°C) Reference
B.birap-1cseq-F TTACGCTGCTTACTACAGCTTCA 1054 57 [7]
  1. Abbreviation: T temperature