Skip to main content

Advertisement

Table 1 Details of the primers used in this study

From: Molecular survey of piroplasm species from selected areas of China and Pakistan

Primer Name Sequence (5'-3') Product size (bp) Annealing T (°C) Reference
RLB-F2 GACACAGGGAGGTAGTGACAAG 393 52 [25]
RLB-R2 CTAAGAATTTCACCTCTGACAGT
RLB-Fint GACAAGAAATAACAATACRGGGC
NBab-1F AAGCCATGCATGTCTAAGTAGAAGCTTTT ~1600 58 [26]
18SRev-BT GAATAATTCACCGGATCACTCG
B.birap-1cseq-F TTACGCTGCTTACTACAGCTTCA 1054 57 [7]
B.birap-1cRc TTACGACGATCGTTTGAAGTACTTC
  1. Abbreviation: T temperature