Skip to main content

Advertisement

Table 1 Primers used to amplify the seven MEP pathway enzyme genes of Babesia orientalis

From: The MEP pathway in Babesia orientalis apicoplast, a potential target for anti-babesiosis drug development

Primer Sequence (5′-3′) Amplicon size (bp)
DXS-F ATGGAGTTGTGTTGTAATC 2094
DXS-R TTAGGATGCAAGGAATTGG  
DXR-F ATGAATGCAGCAGTGAGTTTTTATG gDNA 1554
DXR-R TTAGTATGTGAAGCATTAATATATGTGATAG cDNA 1371
IspD-F ATGTCTGTCTGGTTGGTGCAATG 1344
IspD-R TCACGGGAAGTATACCTCTTTTAG  
IspE-F ATGAGGCATCTCCATGTGTG 1521
IspE-R TCAAGAGATTAGGTCTGGAAGAAG  
IspF-F ATGTTACTACGTTATCTTTCTATAACAG 654
IspF-F TTATAAAGGATATTACTTGAGCTTC  
IspG-F ATGACATCGTCAGACACCTTTG 1932
IspG-R TCACATGCTTCCACATCTGG  
IspH-F ATGGAGGAAAGACCGTTTACC 1056
IspH-R TTATGTAGTTTTCCAGATTCCTATAATCG