Skip to main content

Advertisement

Table 1 Sequence of the primers used for chicken cytokine analysis by RT-qPCR

From: Mutual interactions of the apicomplexan parasites Toxoplasma gondii and Eimeria tenella with cultured poultry macrophages

RNA target Accession No. Primer sequences (5'-3') Reference
Forward Reverse
GAPDH K01458 GGTGGTGCTAAGCGTGTTAT ACCTCTGTCATCTCTCTCCACA [38]
G6PDH AI981686 CGGGAACCAAATGCACTTCGT CGCTGCCGTAGAGGTATGGGA [64]
IFN-γ Y07922 AGCTGACGGTGGACCTATTATT GGCTTTGCGCTGGATTC [38]
IL-6 AJ309540 CAAGGTGACGGAGGAGGAC TGGCGAGGAGGGATTTCT [38]
IL-10 AJ621614 CGGGAGCTGAGGGTGAA GTGAAGAAGCGGTGACAGC [38]
IL-12 NM_213571 AGACTCCAATGGGCAAATGA CTCTTCGGCAAATGGACAGT [38]
TNF-ɑ AY765397.1 CTTCTGAGGCATTTGGAAGC ACTGGGCGGTCATAGAACAG [65]
iNOS U46504 TGGGTGGAAGCCGAAATA GTACCAGCCGTTGAAAGGAC [38]