Skip to main content

Table 1 Gene-specific primers used in this study. Italics denotes RNA polymerase promoter sequences

From: Glutathione S-transferases play a role in the detoxification of flumethrin and chlorpyrifos in Haemaphysalis longicornis

Primer Sequence [5'→3']
L23 real-time forward CACACTCGTGTTCATCGTCC
L23 real-time reverse ATGAGTGTGTTCACGTTGGC
Actin real-time forward ATCCTGCGTCTCGACTTGG
Actin real-time reverse GCCGTGGTGGTGAAAGAGTAG
Tubulin real-time forward TTCAGGGGCCGTATGAGTAT
Tubulin real-time reverse TGTTGCAGACATCTTGAGGC