Skip to main content

Table 1 List of primers used in PCR assays

From: Molecular surveillance and phylogenetic traits of Babesia bigemina and Babesia bovis in cattle (Bos taurus) and water buffaloes (Bubalus bubalis) from Colombia

Organism Target gene Primer Oligonucleotide sequence (5′-3′) Amplicon size (bp) Annealing T (°C) Reference
Babesia spp. 18S rRNA A ACCTGGTTGATCCTGCCAG ~1700 60 [30]
B. bigemina 18S rRNA Bbig200F GCGTTTATTAGTTCGTTAACC ~1200 56 [32]
Mammalian cyt b Cyt bF CCCCTCAGAATGATATTTGTCCTCA ~383 60 [28]
  1. Abbreviation: T temperature