Skip to main content

Advertisement

Table 1 List of primers used in PCR assays

From: Molecular surveillance and phylogenetic traits of Babesia bigemina and Babesia bovis in cattle (Bos taurus) and water buffaloes (Bubalus bubalis) from Colombia

Organism Target gene Primer Oligonucleotide sequence (5′-3′) Amplicon size (bp) Annealing T (°C) Reference
B. bigemina hyp BiIA CATCTAATTTCTCTCCATACCCCTCC 278 63 [26]
BiIB CCTCGGCTTCAACTCTGATGCCAAAG
BiIAN CGCAAGCCCAGCACGCCCCGGTGC 170 70
BiIBN CCGACCTGGATAGGCTGTGTGATG
B. bovis RAP-1 BoF CACGAGGAAGGAACTACCGATGTTGA 350 61 [26]
BoR CCAAGGAGCTTCAACGTACGAGGTCA
BoFN TCAACAAGGTACTCTATATGGCTACC 290 67
BoRN CTACCGAGCAGAACCTTCTTCACCAT
Babesia spp. 18S rRNA A ACCTGGTTGATCCTGCCAG ~1700 60 [30]
B GATCCTTCTGCAGGTTCACCTAC
B. bigemina 18S rRNA Bbig200F GCGTTTATTAGTTCGTTAACC ~1200 56 [32]
Bbig1400R ACAGGACAAACTCGATGGATGC
B. bovis 18S rRNA AN GCTTGTCTTAAAGATTAAGCCATGC ~1550 60 [31]
BN CGACTTCTCCTTCCTTTAAGTGATAAG
Mammalian cyt b Cyt bF CCCCTCAGAATGATATTTGTCCTCA ~383 60 [28]
Cyt bR CCATCCAACATCTCAGCATGATGAAA
Insects cox1 LCOI490 GGTCAACAAATCATAAAGATATTGG ~710 45 [29]
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA
  1. Abbreviation: T temperature