Skip to main content

Advertisement

Table 1 List of primers used for qRT-PCR

From: Molecular basis of permethrin and DDT resistance in an Anopheles funestus population from Benin

Primers Forward Reverse Expected size (bp)
CYP6M7 CCAGATACTGAAAGAGAGCCTTCG CAAGCACTGTCTTCGTACCG 102
CYP6P9a CAGCGCGTACACCAGATTGTGTAA TCACAATTTTTCCACCTTCAAGTAATTACCCGC 92
CYP6P9b CAGCGCGTACACCAGATTGTGTAA TTACACCTTTTCTACCTTCAAGTAATTACCCGC 97
GSTe2 GTTTGAAGCAGTTGCCATACTACGAGG TCAAGCTTTAGCATTTTCCTCCTTTTTGGC 101
GSTd3 CACGGCCAGTCCTCTTTTAG AAGCTTCTTCGCCACCAGTA 128
GSTd1-5 TGGAGAAATACGGCAAGGAC CTTGGCGAAGATTTGTGGAT 140
Aldehyde oxidase GCTCTGAACATTGCACCTCA TGGTGTCGAACGATTGTGTT 109
CYP9K1 AGGGCTTCTGGATACGGTTC CGTACGGTTCGGTTTTGATT 103
RSP7 GTGTTCGGTTCCAAGGTGAT TCCGAGTTCATTTCCAGCTC 98
Actin TTAAACCCAAAAGCCAATCG ACCGGATGCATACAGTGACA 111