Skip to main content

Table 2 Primers used in this study

From: Exploiting genetic polymorphisms in metabolic enzymes for rapid screening of Leishmania infantum genotypes

Target gene GenBank ID Forward primer (5'-3') Reverse primer (5'-3') Amplicon length (bp)
Malic enzymea DQ449701.1 GAGCCGATCAACCGCTATCA TCTTTCTTCATCCCGGCCTC 773
Malic enzymeb DQ449701.1 GGTGTGGCGGAGAGCATC TTGTTGCCTTGCGATGGTTG 458
Malic enzymec DQ449701.1 TCAGAACCTTCGCAAGACGA CACTTGCCGATGCTGATGC 111
Phosphogluconate dehydrogenase AM157139.1 TTCGGCTTCGACAACGATCA CGAGGGAAGTTGGGGAATG 306
Mitochondrial isocitrate dehydrogenase DQ449672.1 CTCCAGCACCAACGTCTACC TACATGCGCTGGAAGGTCTG 708
Glucose-6-phosphate isomerase AJ620617.1 CATTCACCAGGGCACCAAGA TGATCGGAGACGATGTTGCC 426
Glucose-6-phosphate dehydrogenase DQ449770.1 ATGTCGGAAGAGCAGTCTCA CTCCTTCCCGAGGTAGTGGT 765
Phosphoglucomutase KJ643214.1 GGAGACGGTTAAGATTACGCAC TATGCTTCATCGCGGGGTT 413
Mannose phosphate isomerase DQ449737.1 TTTGCGGAGTTGTGGGTAGG CTCGCTGCTCTTCTTCTCGT 864
  1. a5' region
  2. b3' region
  3. cInternal region