Skip to main content

Table 1 Primers targeting the “Ca. N. mikurensis” 16S rRNA gene used for screening and sequencing. Establishment of the primers has previously been described previously [19]

From: Candidatus Neoehrlichia mikurensis” in Ixodes ricinus ticks collected near the Arctic Circle in Norway

Primer Sequence (5'-3')
Neo_16S_F GTAAAGGGCATGTAGGCGGTTTAA
Neo_16S_R TCCACTATCCTCTCTCGATCTCTAGTTTAA
Neo_16S_95_F TTAGTGGCAGACGGGTGAGTAATG
Neo_16S_127_F TCTGCCTAGTAGTATGGAATAGCTG
Neo_16S_1363_R AAACCAATTTCCAGGGCATGACGG
Neo_16S_1393_R TCCTTACGGTTAGCTCACCAGCTT
\