Skip to main content

Advertisement

Table 1 Primers used in the qRT-PCR in the present study

From: Transcriptomic insights into the early host-pathogen interaction of cat intestine with Toxoplasma gondii

Gene Sequence (5'-3') Primer length (mer) Tm (°C) GC % Product length (bp)
β-actin ATTCCACGGCACAGTCAAGG 20 63.39 55 110
CACCAGCATCACCCCATTT 19 61.75 52.63
RSAD2 CACCAGCGTCAACTACCACT 20 59.97 55 140
AATATTCACCGGCTTCCTGC 20 58.32 50
SYCN AAGACGCGCAAGTTCTCGAC 20 61.28 55 117
AAGGCATCAGTAACACCTGCAA 22 60.49 45.45
CELA1 ATGCTACGCTTCTTGGTGCT 20 60.04 50 239
CGGAAGGTCATTTTGCGGTC 20 59.83 50
GKN2 CTTGAAGGTGGTATGCCTGGT 21 60 52.38 214
CCTGGATGCGATGTAGCGAT 20 60.04 55
TFF2 ATGCGTCATGGAAGTCTCGG 22 62.14 50 198
TGACAGTCGTCAACGGACATC 24 61.04 45.83
LYPF TTACACCCGACAAACCCTGA 20 59.24 52.38 132
CAGGTCTCCGGCCTTTATTCT 21 60.67 55
CYP1A1 TCGATACCTACCCAACCCTG 20 58.22 55 246
ACTGTGTCAAATCCAGCTCCG 21 60.61 52.38
CLPS TGCTCTGCCAAGACACTCTAT 21 58.82 47.62 222
5'CAATCAGACAAGGGAGGTGCT 21 60 52.38
CPA2 TGCTCAGTCATCTACCAAGCC 21 59.79 52.38 100
ATCGACCTGTGTCCCTCAGT 20 60.25 55
PRSS2 TACTTCTGCCGCCATGACTC 20 59.82 55 227
TCACTTGGATGCGAGACTTGT 21 59.66 47.62
CPA1 AACGATTTACCAAGCCAGCGG 21 61.55 52.38 210
GCCGAAGGACCAGTTCAGTA 20 59.39 55
FLNC AGTGGTGCCACCCTGTAACC 20 62.06 60 181
CTCTCGCACTTTCACTGGCT 20 60.32 55
FN1 GAACACTAATGTCAACTGCCCA 22 58.85 45.45 125
TGGACCTTGGCAGAGAATCC 20 59.38 55
DES ATGTCCAAGCCAGACCTCAC 20 59.67 55 240
GGAATCGTTGGTGCCCTTGA 20 60.61 55
ACTG2 GTATACTCGGTGCTCAAGCC 20 58.15 55 243
TAGGATCCCTCGCTTGCTCT 20 60.11 55
FABP6 CCCACAGCTACCAACGCTAC 20 60.74 60 185
ATTCTGCTGGAGAGCATCTTCAAT 24 60.39 41.67
MYH11 GCATGCTGCAAGATCGAGAG 20 59.42 55 147
CTTGCGTGATGCTTGTGTCC 20 60.11 55
FGB CCCAATCAACCTTCGTGTGC 20 59.76 55 156
TCCTCACATTCTTTGCCAGACA 22 59.89 45.45
TAGLN AACGGCGTGATTCTGAGCAA 20 60.23 47.2 158
CCACCTGCTCCATTTGCTTG 21 59.78 50
ALPI ACACACCTCATGGGCCTCTT 20 61.14 55 199
TCAGTGCCAGATAAGCCCTG 20 59.46 55
CNN1 TGGCATCATTCTTTGCGAGTTC 22 59.84 45.45 153
TCGAAAATGTCGTGGGGCTT 20 60.25 50
LYPD2 TGAGATGCTACACCTGTCACG 21 59.80 52.38 123
AGAAGGGGTACACTATCTCCAAG 23 58.71 47.83
pCREB CCACAACCATCCGTCCTTCT 20 62.26 55 137
TGTGTGTGTGTGTGTCGGTATGT 23 62.26 47.83
MMP GACGACGATGAGCTGTGGA 19 61.02 57.89 115
TGGTGTATTCCTTGCCGTTG 20 61.85 50
FABP1 CTGATGAAGGTGCCAAGAACAA 22 62.46 45.45 132
GCATTTCCTCACTATTTCCCACTC 24 62.3 45.83
  1. Abbreviation: Tm, melting temperature