Skip to main content

Advertisement

Table 1 Primers used for amplification of Acanthamoeba castellanii genes

From: Molecular and biochemical characterization of key enzymes in the cysteine and serine metabolic pathways of Acanthamoeba castellanii

Gene Primer Sequence (5'-3')
CS CS-ORF-S ATGAAGCACATGACCCCACGC
CS-ORF-AS TTATTGGAGGTACTTGTCGGGAAGG
CS-qPCR-S CTCCGTCCTCTATTCGTAC
CS-qPCR-AS ATGCTCATTGTTTCTTCGT
GDH GDH-ORF-S ATGGACAGCGGTGCGAG
GDH-ORF-AS TCAAGGATTGACGCGCATCA
GDH-qPCR-S GGTCGCATTGGCAAGAGG
GDH-qPCR-AS GCGTCGAGTCCGTGAGGTT
SPAT SPAT-ORF-S ATGGAGGCTGACCGTCCGCTGCT
SPAT-ORF-AS TTAGAGCTTGTTGGGCAGTGCTG
SPAT-qPCR-S TCGCCCGACTTTATCAACCTCT
SPAT-qPCR-AS TGCGCACCGAACGACTCCAA