Skip to main content

Table 2 Sequence of primers used for quantitative RT-PCR

From: NLRP3 inflammasome activation from Kupffer cells is involved in liver fibrosis of Schistosoma japonicum-infected mice via NF-κB

Gene Species Primer sequences (5'-3') Annealing T (°C) Length (bp) GenBank ID
NLRP3 Mouse F: GACCAGCCAGAGTGGAATGAC 60 237 NM_145827.3
R: CTGCGTGTAGCGACTGTTGAG
Caspase 1 Mouse F: GATGGCATTAAGAAGGCCCA 60 229 NM_009807.2
R: CCCTATCAGCAGTGGGCATC
IL-1β Mouse F: GGGCCTCAAAGGAAAGAATCT 60 195 NM_008361.4
R: GAGGTGCTGATGTACCAGTTGG
α-SMA Mouse F: CCACGAAACCACCTATAACAGC 60 236 NM_007392.3
R: GGAAGGTAGACAGCGAAGCC
Collagen I Mouse F: CTGACTGGAAGAGCGGAGAG 60 116 NM_007742.4
R: CGGCTGAGTAGGGAACACAC
GAPDH Mouse F: TGAAGGGTGGAGCCAAAAG 60 227 NM_008084.3
R: AGTCTTCTGGGTGGCAGTGAT
NLRP3 Human F: AAGACAGGAATGCCCGTCTG 60 162 NM_004895.4
R: CCATCTTAATGGGACTCACGG
α-SMA Human F: CTTGAGAAGAGTTACGAGTTGC 60 141 NM_001613.3
R: GATGCTGTTGTAGGTGGTTTC
Collagen I Human F: AAGACAGTGATTGAATACAAAACCAC 60 132 NM_000088.3
R: GGGAGTTTACAGGAAGCAGACAG
GAPDH Human F: CATCATCCCTGCCTCTACTGG 60 259 NM_002046.5
R: GTGGGTGTCGCTGTTGAAGTC
  1. Abbreviations: NLRP3 nod-like receptor protein-3, Caspase 1 cysteinyl aspartate specific proteinase, IL-1β interleukin, α-SMA α-smooth muscle actin, GAPDH glyceraldehyde-3-phosphate dehydrogenase, T temperature